Match the age-related health issue with the nutrient(s) or eating approach that may help prevent it or ease symptoms. Nutritional Intervention Individualizing the texture or consistency of foods served Higher intakes of vitamins C and E Reducing intake of protein from meats and seafood Increasing intake of omega-3 fatty acids found in fatty fish Taking supplements of the omega-3 fatty acid DHA and carotenoids Staying adequately hydrated Weight loss Common Health Issues in Older Adults

Question

16-12-2022
Biology

Answered

Match the age-related health issue with the nutrient(s) or eating approach that may help prevent it or ease symptoms. Nutritional Intervention Individualizing the texture or consistency of foods served Higher intakes of vitamins C and E Reducing intake of protein from meats and seafood Increasing intake of omega-3 fatty acids found in fatty fish Taking supplements of the omega-3 fatty acid DHA and carotenoids Staying adequately hydrated Weight loss Common Health Issues in Older Adults

Answer :

Other Questions

gene encodes a protein with the following amino acid sequence: a nonsense mutation caused by a single-base-pair substitution occurs in this gene, resulting in a

Which of the following could be elements of cytoarchitecture, as related to Brodmann’s microscopic studies of the cerebral cortex? a. connections to the cerebel

select each correct answer. more than one answer may be correct. which of the following statements describes how the characteristics of different species of mam

all organisms face trade-offs that arise from the constraints that they face. one example of a constraint: energy spent on one task cannot be spent on another.

label the trna and mrna with the appropriate terms. also, determine the correct sequence of bases for trna and the correct amino acid for the trna (refer to the

what is the skeletopy, synotopy and holotopy of the lung?

You have been asked to review a medical device that will be used to monitor the breathing pattern of premature infants in a Neonatal Intensive Care Unit (NICU).

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

which of the following foods are good sources of preformed or active vitamin a? (select all that apply.) a. carrots b. sweet potatoes c. leafy greens d. milk e.

You have a friend that is a marathoner and an entrepreneur. He doesn't like lactic acid buildup in his muscles and is tired of them getting so hot when he exerc

RajarshiG RajarshiG · Answer 1 · 2022-12-20T01:54:19-05:00

Increasing intake of omega-3 fatty acids found in fatty fish so this the correct option from the given question

Omega-3 fatty acids are a type of polyunsaturated fatty acid (PUFA) that are essential for human health. PUFAs are considered essential because our bodies cannot make them, so we must get them from our diet. Omega-3 fatty acids play an important role in many physiological processes, including cell growth, immune function, and brain development. They are also important for maintaining healthy cholesterol levels, reducing inflammation, and preventing certain chronic diseases, such as heart disease, stroke, and diabetes. Omega-3 fatty acids are found in a variety of foods such as fish, flaxseed, walnuts, and some vegetable oils. They are also available in supplement form.

Learn more about Omega-3 fatty acids visit here;

https://brainly.com/question/29593274?referrer=searchResults

#SPJ4