Arrange the levels of the taxonomic hierarchy from the group containing the most species to the group containing the fewest. a) Family b) Class c) Order

Question

16-12-2022
Biology

Answered

Arrange the levels of the taxonomic hierarchy from the group containing the most species to the group containing the fewest. a) Family b) Class c) Order

Answer :

Other Questions

select each correct answer. more than one answer may be correct. which of the following statements describes how the characteristics of different species of mam

which of the listed local anesthetics could produce an emergency situation characterized by the inability of the blood to bind to oxygen? group of answer choice

a student studying bird development recorded the mass of eggs from the time they were laid until the time they hatched in order to relate the mass of the egg to

select all of the following that provide evidence that modern species have evolved from prior species. a. molecular biology b. biogeography c. biogeography d. c

29. In a genetic engineering experiment a piece of double-stranded DNA containing 18000 nucleotides coding for a specific polypeptide is transcribed and transl

You have been asked to review a medical device that will be used to monitor the breathing pattern of premature infants in a Neonatal Intensive Care Unit (NICU).

which of the following is the best example of gene flow? group of answer choices genes are shuffled by chromosomal crossing over during meiosis. wind blows poll

what is the skeletopy, synotopy and holotopy of the lung?

variegated limpets are a different species from olive limpets. they live on the same rocky benches along the same sea shore, and eat the same kinds of foods. th

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

jaspreetsharma jaspreetsharma · Answer 1 · 2022-12-20T03:44:54-05:00

A) Family b) Class c) Order a) Domain e) Kingdom d) Phylum b) Class c) Order a) Genus

Seven levels make up Linnaeus' hierarchical categorization scheme. They are kingdom, phylum, class, order, family, genus, & species, in order of largest to smallest. 2. Each level is referred to in taxonomic nomenclature as a taxon (plural: taxa) as well as taxonomic group. Kingdom, phylum as well as division, class, order, family, genus, & species are the seven major taxonomic ranks. Additionally, although not being listed in any nomenclature regulations, domain (proposed by Carl Woese) now is frequently used as a fundamental rank and is a synonym of dominion (lat. Eight levels of taxa make up the Linnean system, which is still widely used today. From most broad to most particular, these levels include domain, kingdom, phylum (plural, phyla), class, order, family, and genus (plural, genera),

(Arrange the levels of the taxonomic hierarchy from the group containing the most species to the group containing the fewest.

a) Family

b) Class

c) Order

d) Phylum

e) Kingdom

f) Genus)

Learn more about family

https://brainly.com/question/29394958

#SPJ4