montesta83 montesta83

16-12-2022
Biology

Answered

Which of the following positively contributes to the genetic variation of a population gene pool? A change in the DNA sequence within a gene or chromosome of a living organism. Random fluctuationsin the frequency of appearance of a gene in a small population. A populations size is reduced for at least one generation. A new colony is established by a very small number of individuals away from a larger population.

Answer :

Other Questions

A new organism, Organism E, has been discovered. How could scientists use its DNA to compare and classify this new organism?

5. Below is the DNA sequence for the orange tiger and the mutated DNA sequence of the white tiger. Look at both sequences and explain a. what type of mutation t

10 A zoologist finds that an injured cheetah can be treated with a skin graft from an unrelated cheetah, and there is no rejection of the skin graft by the immu

a large population of cockroaches was sprayed with an insecticide. a few of the cockroaches survived and produced a population of cockroaches that was resistant

ACROSS 2. (1942) World War II battle in which the Britain won a decisive victory over Germany in Egypt, securing the Suez Canal 6. (1940) three-month air batle

original DNA: TACTTTAATCCCAAATTTACT DNA: TACTATAATCCCAAATTTACT mRNA: ? amino acid: ? what type of mutation is this: ?

original DNA: TACTTTAATCCCAAATTTACT DNA: TACTTTAATCGAAATTTACT mRNA: ? amino acid: ? what type of mutation is this: ?

What conclusion is supported by the data in the graph? The graph below shows the levels of halogens in the atmosphere for several years after the legislation wa

It is not likely that any living organism could survive on the Martian surface because of O ultraviolet radiation O warm temperatures O abundance of water

Whether the information is sufficient to allow predication of the response of an organism to be different stimuli based on cause and effect relationships betwee