sharidler sharidler

15-12-2022
Biology

Answered

original DNA: TACTTTAATCCCAAATTTACT DNA: TACTTTAATCGAAATTTACT mRNA: ? amino acid: ? what type of mutation is this: ?

Answer :

Other Questions

here is a hypothetical mrna sequence: 5' c g g a u g c g u a a a u a g 3' what is the amino acid sequence encoded by this mrna?

Why are the differences between prokaryotic and eukaryotic translation of mRNA useful to humans?

cosmic rays are a major risk to human spaceflight due to their potential to break dna in cells. overall cosmic ray flux in the solar system do :

hen t or b cells are activated, they proliferate, forming a group of genetically identical cells descending from the original activated cell. what is the name o

How many of the following can be used to distinguish a nematode worm from an annelid worm?1. type of body cavity2. number of muscle layers in the body wall3. pr

a wild-type fly (heterozygous for gray body color and red eyes) is mated with a black fly with purple eyes. the offspring are: wild-type 721 black-purple 751 gr

What conclusion is supported by the data in the graph? The graph below shows the levels of halogens in the atmosphere for several years after the legislation wa

describe which type of morality kenny is displaying when he makes the decision to steal medical supplies for the homeless man. watch both examples of sara’s rep

How does this equation compare to the equation for photosynthesis?