Yaya03uwu Yaya03uwu

16-12-2022
Biology

Answered

A new organism, Organism E, has been discovered. How could scientists use its DNA to compare and classify this new organism?

A new organism Organism E has been discovered How could scientists use its DNA to compare and classify this new organism class=

Answer :

Other Questions

It is not likely that any living organism could survive on the Martian surface because of O ultraviolet radiation O warm temperatures O abundance of water

How does this equation compare to the equation for photosynthesis?

examine the phylogenetic tree showing the evolutionarily relationships of five organisms which statement most accurately explains the relationship between organ

original DNA: TACTTTAATCCCAAATTTACT DNA: TACTATAATCCCAAATTTACT mRNA: ? amino acid: ? what type of mutation is this: ?

original DNA: TACTTTAATCCCAAATTTACT DNA: TACTTTAATCGAAATTTACT mRNA: ? amino acid: ? what type of mutation is this: ?

5. Below is the DNA sequence for the orange tiger and the mutated DNA sequence of the white tiger. Look at both sequences and explain a. what type of mutation t

Bats in the genus Myotis look identical and have always been classified as one species, even though behavioural differences have been observed. Recently, scient

Use the mRNA chart above to transcribe and then translate the DNA below.

Classify the components as most accurately describing cofactors, coenzymes, or neither. a. Zn2+ b. FAD c. metel ion d. CoA

2.)Which option best describes a scientific consensus? (1 point) an observation made by a scientist that is supported by experimentation and investigation a gen