drag the images into the corresponding boxes to indicate the correct order of events illustrating the mechanism of antibody-mediated immunity.

Question

09-12-2022
Biology

Answered

drag the images into the corresponding boxes to indicate the correct order of events illustrating the mechanism of antibody-mediated immunity.

Answer :

Other Questions

Concept Review: Calculating Doubling Time Part A Part complete Drag the values on the left to the appropriate blanks on the right to complete the sentences. Not

Cold sores on the skin of the mouth occur when herpes simplex viruses that are dormant in neural ganglia become active and travel to the skin of the mouth. Whic

a student studying bird development recorded the mass of eggs from the time they were laid until the time they hatched in order to relate the mass of the egg to

label the trna and mrna with the appropriate terms. also, determine the correct sequence of bases for trna and the correct amino acid for the trna (refer to the

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

You have been asked to review a medical device that will be used to monitor the breathing pattern of premature infants in a Neonatal Intensive Care Unit (NICU).

More than one of the following may be correct. Select all correct choices. A sharp increase in capillary hydrostatic pressure would directly cause

Which of the following should be labeled with the patient's name, the date and time of collection, and the initials of the person collecting the specimen?

what is a pluripotent stem cell? cells found in the inner cell mass that of the blastocyst that can differentiate into any of the cell types except placental ce

what is the skeletopy, synotopy and holotopy of the lung?

NomulaHarsh NomulaHarsh · Answer 1 · 2022-12-23T02:40:06-05:00

A macrophage initially engulfs the infection. Step two involves the breakdown of the bacteria by the macrophage and the appearance of the pathogen's antigens. The third phase entails the activation of a T helper cell via its attachment to a macrophage. Step 4: A T helper cell that has linked to another B cell causes a B cell to be activated.

How does immunity mediated by antibodies function?

The effector response of the antibody-mediated immune response is finished in three steps: development and activation of B cells to produce antibodies. a modification to antibody class. Antibodies facilitate antigen clearance.

What should the dialogue sound like in a hilarious response?

The events of the comedic reaction are depicted in the timeline below.

1) Pathogen-eating macrophages express an antigen on MHC II markers unique to TH cells.

2) Specific TH cells cling to the MHC II complex via specific cell receptors.

3) An activated TH cell multiplies and generates interleukin II.

To learn more about immunity click:

https://brainly.com/question/26864713

#SPJ4