A plasma membrane protein begins with a large hydrophilic regulatory domain. This is followed by six hydrophobic regions of 20+ amino acids, with short hydrophilic regions in between. Finally, a large hydrophilic domain, called domain A, is at the end of the polypeptide. The first signaling sequence of this protein is an N-terminal signal sequence.
If all six hydrophobic domains cross the membrane one time each, then it is possible that
the regulatory domain and domain A will be on the same side of the membrane
the regulatory domain and domain A will both be intracelluar
the regulatory domain and domain A are transmembrane domains
the regulatory domain is intracellular and domain A is extracellular
Choices A and B are both possible

Question

06-12-2022
Biology

Answered

A plasma membrane protein begins with a large hydrophilic regulatory domain. This is followed by six hydrophobic regions of 20+ amino acids, with short hydrophilic regions in between. Finally, a large hydrophilic domain, called domain A, is at the end of the polypeptide. The first signaling sequence of this protein is an N-terminal signal sequence.
If all six hydrophobic domains cross the membrane one time each, then it is possible that
the regulatory domain and domain A will be on the same side of the membrane
the regulatory domain and domain A will both be intracelluar
the regulatory domain and domain A are transmembrane domains
the regulatory domain is intracellular and domain A is extracellular
Choices A and B are both possible

Answer :

Other Questions

protein folding none of the responses are correct is completed by the time the protein is released from the ribosome is govern solely by the chemistry of the pr

Using the following chart, which chain of amino acids would be produced by the sequence of this very short, complete mRNA: UAUUAUGCCUGAGUGAAUUGCUA?

Both Aristotle and Linnaeus classified all living things as plants or animals. Today, scientists use a classification system that involves three domains, six ki

label the trna and mrna with the appropriate terms. also, determine the correct sequence of bases for trna and the correct amino acid for the trna (refer to the

Free-floating periodontal pathogens can cause periodontal disease. Biofilm development always begins supragingival. Select one: A. Both statements are true B. B

Which of the following should be labeled with the patient's name, the date and time of collection, and the initials of the person collecting the specimen?

DRAW IT : The graph here shows the pH difference across the inner mitochondrial membrane over time in an active respiring cell. At the time indicated by the ver

Transcription of a part of a DNA molecule with a nucleotide sequence of A-A-A-C-A-A-C-T-T results in a mRNA molecule with the complementary sequence of:

In a large, randomly mating, population, the frequency of the allele for sickle-cell hemoglobin (s) is 0.028. The results of studies have shown that people with

pick the correct match. no cell wall, only plasma membrane: no large vacuole, only small ones: no chlorophyll or chloroplasts: cell plate and no centrioles in c

abhinavjh321 abhinavjh321 · Answer 1 · 2022-12-08T12:37:10-05:00

Option D is the correct answer, The mutation stops G-alpha plasma membrane from hydrophilic regulatory domain attaching to GTP. Domain A is extracellular, while the regulatory domain is intracellular. which inhibits glycogenolysis is by a mutation.

Despite the absence of a ligand, the G protein would still be functioning and signaling. The release plasma membrane of the bound trimeric hydrophilic regulatory domain G protein (inactive) from the receptor plasma membrane and the dissociation of the active a subunit (GTP-bound) and bg dimer are made possible by the binding of GTP, which modifies the conformation of switch areas within the a subunit. When an extracellular plasma membrane signal binds hydrophilic regulatory domain to a G-protein-coupled receptor, GDP is changed into GTP and the G-protein is able to attach to the receptor.

learn more about hydrophilic regulatory domain here:

https://brainly.com/question/25380853

#SPJ4