which of the following is the multicellular cytoplasmic mass formed from the outer layer of the trophoblast as it implants into the endometrium?

Question

05-12-2022
Biology

Answered

which of the following is the multicellular cytoplasmic mass formed from the outer layer of the trophoblast as it implants into the endometrium?

Answer :

Other Questions

a student studying bird development recorded the mass of eggs from the time they were laid until the time they hatched in order to relate the mass of the egg to

You have been asked to review a medical device that will be used to monitor the breathing pattern of premature infants in a Neonatal Intensive Care Unit (NICU).

what is the skeletopy, synotopy and holotopy of the lung?

what is a pluripotent stem cell? cells found in the inner cell mass that of the blastocyst that can differentiate into any of the cell types except placental ce

Which of the following could be elements of cytoarchitecture, as related to Brodmann’s microscopic studies of the cerebral cortex? a. connections to the cerebel

a nucleus with mass number and atomic number undergoes decay (positron emission). the mass number and atomic number, respectively, of the product nucleus are

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

from the following choices, choose all of the answers that increase the genetic variation among individuals in a sexually reproducing population of a plant that

which of the following is the best example of gene flow? group of answer choices genes are shuffled by chromosomal crossing over during meiosis. wind blows poll

the arctic tundra has remained frozen for thousands of years but is slowing thawing as global temperatures increase. once thawed, the environment and ecosystems

akursharma9034 akursharma9034 · Answer 1 · 2022-12-08T22:26:45-05:00

After binding to the endometrium, trophoblasts develop into two distinct layers, an inner layer of mononuclear cytotrophoblasts and an outer layer of continuous multinuclear cytoplasm, the syncytiotrophoblasts, which form the early fetal-maternal interface (placenta)

Trophoblast cells and extraembryonic somatic mesoderm develop into the chorion, a membrane that encloses the chorionic cavity. The connecting stalk connects the embryo and yolk sac to the chorion and suspends them in the chorionic sac.

Learn more about the endometrium,

https://brainly.com/question/29602550

#SPJ4