under the terms of the secret treaty of san ildefonso in 1800 between france and spain, france regained title to the vast louisiana territory as part of napoleon's grand design to

Question

05-12-2022
Biology

Answered

under the terms of the secret treaty of san ildefonso in 1800 between france and spain, france regained title to the vast louisiana territory as part of napoleon's grand design to

Answer :

Other Questions

You have been asked to review a medical device that will be used to monitor the breathing pattern of premature infants in a Neonatal Intensive Care Unit (NICU).

label the trna and mrna with the appropriate terms. also, determine the correct sequence of bases for trna and the correct amino acid for the trna (refer to the

Concept Review: Calculating Doubling Time Part A Part complete Drag the values on the left to the appropriate blanks on the right to complete the sentences. Not

in fruit flies red eye color (R) is dominant to white eyes (r) in a cross between two flies, 50% of the male and 50% of the female offspring had red eyes. The o

Which of the following could be elements of cytoarchitecture, as related to Brodmann’s microscopic studies of the cerebral cortex? a. connections to the cerebel

what is the skeletopy, synotopy and holotopy of the lung?

a student studying bird development recorded the mass of eggs from the time they were laid until the time they hatched in order to relate the mass of the egg to

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

in biology, the relationship between form and function is critical. briefly explain how this is apparent at the level of the cell. your answer should include a

which of the following is the best example of gene flow? group of answer choices genes are shuffled by chromosomal crossing over during meiosis. wind blows poll

kumarravichandra kumarravichandra · Answer 1 · 2022-12-08T04:48:08-05:00

under the terms of the secret treaty of san ildefonso in 1800 between france and spain, france regained title to the vast louisiana territory as part of napoleon's grand design to Build a great French empire in America

Napoleon Bonaparte established French hegemony over much of continental Europe at the start of the 19th century, establishing the First French Empire, officially the French Republic[b], then the French Empire (French: Empire Français; Latin: Imperium Francicum) after 1809, also known as Napoleonic France. It lasted for two brief periods: from 20 March 1815 to 7 July 1815, and from 18 May 1804 to 11 April 1814.

Despite having a colonial empire in other parts of the world since the early 17th century, France had remained a kingdom under the Bourbons and a republic following the French Revolution. To distinguish it from his nephew Napoleon III's restorationist Second Empire (1852–1870), historians refer to Napoleon's tenure as the First Empire. Some people refer to the First French Empire as a "Republican empire."

Napoleon was crowned on 2 December 1804,[9] marking the end of the French Consulate and of the French First Republic, and on 18 May 1804, the French Sénat conservateur bestowed upon him the title Emperor of the French (Empereur des Français, pronounced [.poe de f.s]). The empire was still known as the "French empire " after his coronation until 1809. Through important victories in the War of the Third Coalition over Austria, Prussia, Russia, Britain, and allies, particularly at the Battle of Austerlitz in 1805, the French Empire attained military dominance in continental Europe. [10] Before Napoleon's ultimate defeat at the Battle of Waterloo in 1815, French dominance was reaffirmed during the War of the Fourth Coalition at the Battles of Jena-Auerstedt in 1806 and the Battle of Friedland in 1807.

Learn more about French empire here:

https://brainly.com/question/2116020

#SPJ4