The spinal cord extends inferiorly from the brain through the foramen magnum and ends at thelevel of the __________ vertebra.L1L5S1S5

Question

05-12-2022
Biology

Answered

The spinal cord extends inferiorly from the brain through the foramen magnum and ends at thelevel of the __________ vertebra.L1L5S1S5

Answer :

Other Questions

these senses will not cross between brain hemispheres in someone who has had a corpus callosotomy (split-brain procedure):

i. describe (list) the events from the time calcium ions enter the terminal axon at the neuromuscular junction through muscle cell contraction.

what is a pluripotent stem cell? cells found in the inner cell mass that of the blastocyst that can differentiate into any of the cell types except placental ce

During translation, the amino acid detaches from the transfer RNA molecule and attaches to the end of a growing protein chain when a. the ribosomal RNA anticodo

what is the skeletopy, synotopy and holotopy of the lung?

You have been asked to review a medical device that will be used to monitor the breathing pattern of premature infants in a Neonatal Intensive Care Unit (NICU).

a student studying bird development recorded the mass of eggs from the time they were laid until the time they hatched in order to relate the mass of the egg to

You are going mountain climbing and get flown by helicopter from sea level to base camp which is a considerable elevation gain. How will your body respond to th

variegated limpets are a different species from olive limpets. they live on the same rocky benches along the same sea shore, and eat the same kinds of foods. th

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

jaspreetsharma jaspreetsharma · Answer 1 · 2022-12-08T03:44:15-05:00

Through the foramen magnum, this spinal cord travels inferiorly from of the brain and terminates at the position of the cervical vertebra.

The cord therefore extends through 20 bony vertebrae. It ends in a kid at the top L3 border. A dermatome is innervated by each of these segments. The spinal cord runs from the initial lumbar vertebra level to the foramen magnum just at base of the skull. At the foramen magnum, the cord continues into the medulla oblongata. The spinal cord is encased in bone, meninges, & cerebrospinal fluid, just like the brain. The central nervous system, that includes the spinal cord, is extended by the spinal cord. The spinal cord starts in the medulla oblongata, which is located at the base of the brain stem, and ends inside the lower back, where it tapers to create a cone known as the conus medullaris.

Learn more about brain

https://brainly.com/question/2664243

#SPJ4