The sausage from Paul's breakfast would mostly contain ______ that may negatively impact his blood cholesterol (lipoprotein) levels.

Question

05-12-2022
Biology

Answered

The sausage from Paul's breakfast would mostly contain ______ that may negatively impact his blood cholesterol (lipoprotein) levels.

Answer :

Other Questions

is the liquid portion of blood in which blood cells are suspended. contains albumin and globulins. is mostly water. contains fibrinogen. all of these choices ar

Which of the following would be an example of a biological influence into the development of a pathological fear of the sight of blood? a. The immediate assista

routine monitoring of water in a reservoir has found a high count of e. coli. of the following, you would be most concerned that the contaminated water might al

More than one of the following may be correct. Select all correct choices. A sharp increase in capillary hydrostatic pressure would directly cause

-------- alveolar cells provide the primary diffusional area for gas exchange with the blood in the lung

what is a pluripotent stem cell? cells found in the inner cell mass that of the blastocyst that can differentiate into any of the cell types except placental ce

if two populations of the same species have different mating seasons, one in fall and the other in spring, this may lead to a speciation event due to

Baby timothy suffers from apnea and is hooked up to a monitor to warn his parents when he stops breathing. timothy's dad snores very loudly. timothy's condition

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

from the following choices, choose all of the answers that increase the genetic variation among individuals in a sexually reproducing population of a plant that

jaiswalsaurabh45609 jaiswalsaurabh45609 · Answer 1 · 2022-12-07T23:13:29-05:00

The sausage from Paul's breakfast would mostly contain saturated fats that may negatively impact his blood cholesterol (lipoprotein) levels.

Dietary fats include saturated fat. Along with trans fat, it is one of the harmful fats. Most of the time, these fats are solid at room temperature. High quantities of saturated fat are found in foods like butter, cheese, red meat, palm and coconut oils, and butter.

The consumption of excessive amounts of saturated fat can cause heart disease and other health issues.

Generally saturated fats do not have any double or triple binds in carbon atoms of fatty chains.

To know more about saturated fats, click here,

brainly.com/question/21727368

#SPJ4