mynameisrosa1093 mynameisrosa1093

13-11-2022
Biology

Answered

12. A fossil was found in a sedimentary rock layer. The igneous layer directly above
the sedimentary layer was analyzed for radioactive uranium. You found equal
amounts of uranium and lead in the igneous sample. This means that the
relative / absolute age of the igneous layer is 704 million years, and the
age of the fossil in the sedimentary rock layer below is older / younger than
704 million years.

12 A fossil was found in a sedimentary rock layer The igneous layer directly above the sedimentary layer was analyzed for radioactive uranium You found equal am class=

Answer :

Other Questions

Bonus Question: What is the height of the plant that was kept in the sun for 3 hours on day 10? 4. This line graph compares the growth of plants that were kept

3 What is the meaning of an importance value! Why would we calculate this in addition to density, cover- age, and frequency?

PLSSS HELPPP 50 POINTS!! (that's all I have :) Designing an Investigation to Test the Activity of Yeast Cells in Anaerobic Conditions: In this part of the lab,

Using the following genomic sequence: 1) Underline each intron 2) Circle each exon UUUAUGACUAAUGAUGAAUAAUAUAUGAUGCGUAGUAAUCCUUCUGCAGAUUAG AUAAUGUUUUUACCCACCAACG

WORTH 100 POINT Specialized cells are not genetically identical because they have different structures and functions. True False The center of this image show

PLSSS HELPPP 100 POINTS!! (that's all I have :) Designing an Investigation to Test the Activity of Yeast Cells in Anaerobic Conditions: In this part of the lab,

explain the importance of the following. a The trachea wall contains C-shaped rings of cartilage. b The distance between the air in an alveolus and the blood i

Procedure Note: The procedures for this lab as shown in the video are very good if you need extra help. 1. Tape the black paper to the outside of the jar so tha

Suppose you spend years biochemically purifying an integral membrane protein from a highly pathogenic, brain infecting species of amoeba (a eukaryote). You perf

Two lizard species both forage in fig trees in the Caribbean. To study potential competition between the species, you observe a sample of both species, observin