cadenaam11 cadenaam11

13-11-2022
Biology

Answered

Spot phenotype in beans is determined by a single gene. A true-breeding strain of beans with large
spots is crossed with a true-breeding strain with small spots. All of the F1 progeny have both large
spots and small spots. Which of the following terms best describes the relationship displayed by the
large and small spot alleles.

Answer :

Other Questions

If the initial gene pool of beaker is R25, B25. What is the initial gene frequency

explain the importance of the following. a The trachea wall contains C-shaped rings of cartilage. b The distance between the air in an alveolus and the blood i

Noah developed a model of how genes are acquired by offspring in sexual reproduction. He used two baskets-one to represent each parent. He placed two slips of p

Violet flowers are the dominant trait and white flowers are they recessive trait .what would the phenotype be for a heterozygous flower? a. violet b. white If

WORTH 100 POINT Specialized cells are not genetically identical because they have different structures and functions. True False The center of this image show

PLEASE, PLEASE, PLEASEE!!! EXPLAIN IN DETAIL HOW THE TWO RELATES TO THE CELL THEORY The following lists components of the nature of science. Explain how at le

Two lizard species both forage in fig trees in the Caribbean. To study potential competition between the species, you observe a sample of both species, observin

Using the following genomic sequence: 1) Underline each intron 2) Circle each exon UUUAUGACUAAUGAUGAAUAAUAUAUGAUGCGUAGUAAUCCUUCUGCAGAUUAG AUAAUGUUUUUACCCACCAACG

Where is the green florescence gene added in the plasmid? Why?

A cell is the smallest unit of biological organization that has all of the characteristics of life. Which of the following are considered characteristics of lif