simontsoku simontsoku

29-03-2024
Biology

Answered

Draw a pie chart to illustrate the relative proportions of protein, carbohydrates, fats and Fibre of this 100g of cereal

Answer :

Other Questions

rhesus factor is an inherited protein found on the surface of red blood cells. the presence of the protein, Rh positive, is dominant over the absence of the pro

Explain how natural selection is the process by witch favorable tend to increase in frequency over time. How does this experiment illustrate natural selection

protein that consists of 33 amino acids would be coded for by a gene that is made up of how many bases??

What type of evidence is this?

When methane, CH4, is combusted, it produces carbon dioxide, CO2, according to the unbalanced equation: CH4 + O2 → CO2 + H2O. Write the balanced equation for t

What is the likely advantage of growing a genetically modified variety of corn that possesses its own pesticide? A: The shelf life and sale of corn would incr

CTGTTACTTTCAATCGTACACCAACACTGCTTTC Translate and transcribe this strand of DNA into mRNA and amino acids.

Identify the practice by which humans use biological understanding to solve practical problems, and give an example of this practice.

Provide Biology definitions for the following terms: gene, DNA, protein, allele, carrier, karotype, sex-linked multiple alleles, polygenic inheritance, codminan