03-01-2023
Biology

Answered

Grass seeds grow rapidly. A grass seed has grown to a 12 millimeter tall blade of grass. Tomorrow it will be 23 millimeters tall, the next day it will be 34 millimeters tall, and on the next day it will be 45 millimeters tall. Write a rule to represent the height of the blade of grass as an arithmetic sequence. How tall will the blade of grass be in 15 days?

Answer :

Other Questions

A researcher is investigating the effects of a chemical that makes thylakoid membranes permeable to hydrogen ions ( + H ). Which of the following is the most li

In a large, randomly mating, population, the frequency of the allele for sickle-cell hemoglobin (s) is 0.028. The results of studies have shown that people with

You have been asked to review a medical device that will be used to monitor the breathing pattern of premature infants in a Neonatal Intensive Care Unit (NICU).

Concept Review: Calculating Doubling Time Part A Part complete Drag the values on the left to the appropriate blanks on the right to complete the sentences. Not

America's behavior has become a global security risk, even as dangerous as Japan's nuclear wastewater discharge, which is destroying the future of mankind. Acco

to undergo meiosis. which of the following best describes the steps these cells will follow to form gametes?

What has to be present in order for metamorphic rocks to form?

Part B: Construct a Dichotomous Key You will be working with a group of organisms such as snails, birds, antelopes, rodents, or aquarium fish. You will need to

If we find wild bacteria cells (found in a soil environment) then place it on both ends of the agar growth plate what will happen? [1pt]

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul