axesolrio519 axesolrio519

14-11-2022
Biology

Answered

3. When did oceans first appear?
4. During which period did the atmosphere reach its current oxygen rich state?
5. During which period did land organisms appear? How many millions of years ago did this take place?
6. During which period did the first primates appear? During which period did humans appear?

Answer :

Other Questions

Two lizard species both forage in fig trees in the Caribbean. To study potential competition between the species, you observe a sample of both species, observin

31. Use the diagram to answer the question below. What would happen to the solar energy that reaches Earth's atmosphere if the ground was covered w (1 point) 30

Describe development during the germinal, embryonic, and fetal periods. Identify one possible developmental complication during gestation and what factors might

Can you pls help if you did you will earn a lot of points

Using the following genomic sequence: 1) Underline each intron 2) Circle each exon UUUAUGACUAAUGAUGAAUAAUAUAUGAUGCGUAGUAAUCCUUCUGCAGAUUAG AUAAUGUUUUUACCCACCAACG

Consider the following mRNA molecule: AUGUUUGAUUUAAACCAAUGA. You are trying to generate the longest polypeptide from the mRNA molecule. Assume translation can s

Blossom Company purchased a new machine on October 1, 2022 at a cost of $92,100. The company estimated that the machine has a salvage value of $7,260. The machi

When you revised your track, how did the law od conservation of energy lead to less kinetic energy than your first track. Be sure to mention the connection to g

How can this graph be changed to show climate data instead of weather data? A. by showing monthly totals instead of daily and adding historical monthly averages

Supplemental Activities (These are optional and not graded - please do not submit) 1. Research and write a paper about two famous earth scientists. 2. Research