MumtazV557045 MumtazV557045

26-10-2022
Biology

Answered

41. Mitochondrial DNA from Africans was recently discovered to be more variable than mitochondrial DNA from populations in other parts of the world. Which of the following ideas is supported by this finding?A. the Out-of-Africa hypothesisB. the multiregional theoryC. the hominoid biogeographical hypothesis

Answer :

Other Questions

What type of nucleic acid is found in a virus?Select one:a.RNA onlyb.DNA or RNAc.DNA and RNAd.DNA only

tion 36/63 > NEXT BOOKMARK X Why does the DNA have to be copied before mitosis? A it doesn't need to be copied, if the cell divides the DNA should divide too

1. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACATCCGCTTACGTCTGATCGCT 5' Type of mutation ( 3pts): Amino ac

100 point please answer Central dogma includes the following:The DNA codes for the production of messenger RNA (mRNA) during transcription.In eukaryotic cells,

suppose that out 10 trees planted in a yard only five survived. what kid of hypothesis could you make about this observation or event?

Identify the stage of this graph in which population grows the fastest and explain why this is the case. Describe one economic or societal indicator of a countr

You are part of a research group that is attempting to improve on the beneficial genetic modification of golden rice, to further reduce global hunger issues. Wh

8. In this beaker, the internal environment of the cell is greater than the solution outside of the cell. What is this called? (Hint: Hypotonic, Hypertonic, and

1. An organism isfor a gene if it has two copies of the same allele forthe gene.2. The genotype of an organism and the interaction of the genotype with theenvir

SEQUENCING INFORMATION One reading skill is the ability to sequence information, or to logically place items or events in the order in which they occur. Sequen