Answered

1. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACATCCGCTTACGTCTGATCGCT 5' Type of mutation ( 3pts): Amino acid ( 3pts):



Answer :

>>Convert DNA to mRNA so it will be easier to read the codon table for the amino acids.<<

mRNA sequence (original DNA): 3' AUG-GCG-AAU-GCA-GAC-UAG 5'

mRNA sequence (mutated DNA): 3' AUG-UAG-GCG-AAU-GCA-GAC-UAG 5'

Type of mutation: Frameshift mutation. It is a type of mutation wherein there is an insertion (adding) or a deletion (removing) of one or more nucleotides that changes the reading frame of the base sequence.

Amino acid sequence: Refer to the genetic codon table.

For Original DNA sequence: Met-Ala-Asn-Ala-Asp-Stop

For Mutated DNA sequence: Met-Stop-Ala-Asn-Ala-Asp-Stop

Other Questions