yasminealtinawi yasminealtinawi

10-03-2024
Biology

Answered

In the sequence below, find the recognition sites for the following restriction enzymes: AvrII (CICTAGG), BamHI (G GATCC), BglII (A GATCT), BshNI (GIGYRCC), KpnI (GGTACIC), and TatI (WIGTACW), where the "" symbol in NINNNNN shows the cleavage position on one strand, Y means either pyrimidine, R means either purine, and W (weak) means either an AT or a TA basepair.
a) Box the sites, and label them with the first 2 letters of the enzyme name (use Ba for BamHI)
b) Which sites generate compatible (cohesive, sticky, complementary) overhangs that can be used to join fragments with DNA ligase?
AACGTTGGTACCTAGGAGATCTGGATCCTAGGAGTACTGGCGCCAACGIT TTGCAACCATGGATCCTCTAGACCTAGGATCCTCATGACCGCGGTTGCAA

Answer :

Other Questions

Fill in the blanks with the correct answers using words from the list. cell characteristics chromosomes daughter DNA father's genes genetics God inherited singl

In cats, the "colorpoint" pattern results in darker colors around the face, ears, legs, and tail and lighter colors over the rest of the body. This is due to th

Which of the following is NOT true of the endomembrane system It has many folds. The lumen is not in contact with the cytoplasm. It releases its contents

The G and H loci are 14 m.u. apart. If a plant of genotype __G___H__ __g___h__ is selfed (mated with itself - you can do that with plants!), what will the gam

How would you answer the following question during an interview? Using the work experience information on your resume, explain why you would be a good candidat

Analyze the data and use it to answer the question. Renewable Energy Data: Renewable Energy Source Efficiency (%) Carbon Emissions (gCO2/kWh) Lifecycle Analysis

Fur Color in Rabbits Generation Brown Fur Mottled Fur White Fur 1 45 0 1 2 47 2 The mechanism that Darwin proposed for evolution is natural selection.Because r

c. Which, if any, of the artificial saliva dilutions resulted in "negative Lugols (yellow-orange)" at well 1? What can you conclude about the amount of amylase

Copy the incomplete cellular diagrams into your notebook. Thenlabel the missing parts of the cellsThink back to what you learned during the Energy Flow Lessonan

What function is associated with dendritic cells in the epidermis? a. Pigmentation b. Phagocytic immune defense c. Sensation d. Keratin production