saniyahsherman saniyahsherman
  • 06-03-2024
  • Biology
Answered

Animals release ___ into the atmosphere through_____



Answer :

Other Questions

Biologists studying the feeding behavior of a species of vole note that the animals are more active when there is no sunlight or the sky is heavily overcast. be
BUILD Vocabulary artificial selection selective breeding of plants and animals to promote the occurrence of desirable traits in offspring Root Word Artificial
A species of frogs is found in freshwater ponds that are distributed along 2500 Km in spite of the coastal plain Hemisphere. The average size of frogs varies in
Describe how cellular respiration moves carbon in particular. What are the two main inputs (reactants) for the process of cellular respiration Describe how cell
Create the complementary strand for the DNA strand below. Make sure to label the parts and the direction of the strand. 5'AACGGTCCAGTCCAAGTTACG'3
20. Polar bears have coats that help them survive in the cold Arctic where they live. The color of the coat helps them to blend in with their environment . The
Looking at your BBD, give an example of a muscle (not any from the station 1 card!!) that are named for each of the following: a. The muscle's location b. The m