Shaiansbus Shaiansbus

05-03-2024
Biology

Answered

Which mutation will cause translation
to STOP?
The table shows a DNA sequence and three types of mutations that can change the DNA
sequence.

Which mutation will cause translation to STOP The table shows a DNA sequence and three types of mutations that can change the DNA sequence class=

Answer :

Other Questions

What would be the strand of complementary DNA produced by the strand of DNA TCG AAG? AGC TTC TCG AAG AGC UUC ACG TTC

Match each biological polymer to the correct example. a) Carbohydrate - Starch b) Nucleic acid - DNA c) Protein - Enzyme d) Lipid - Cholesterol

Create the complementary strand for the DNA strand below. Make sure to label the parts and the direction of the strand. 5'AACGGTCCAGTCCAAGTTACG'3

how are the nucleotides on one strand of dna molecule arranged when compared to the opposite side strand?

In pea plants, Mendel observed several traits that had two alleles. However, not all traits exhibit this pattern of inheritance. In the Mongolian gerbil, there

After two cell divisions, what percentage of cells have an aflatoxins-induced mutation

BUILD Vocabulary artificial selection selective breeding of plants and animals to promote the occurrence of desirable traits in offspring Root Word Artificial

A population of bacteria is exposed to the antibiotic penicillin. Most of the bacteria die. However, some bacteria in the population have an allele coding for a

The image illustrates one method of sustainable development: a building with a green roof. Buildings with green roofs are covered in living vegetation. Which of