makaylapark668 makaylapark668

27-12-2022
Biology

Answered

the pharmacogenetic profiling reveals a mutation in a cyp450 enzyme that causes increased enzyme activity. which of the statements below is incorrect? - There are variations in the enzymes as a result of genetic polymorphism
- It would require that the patient with this mutation is given greater than the standard dose of a drug if it is metabolized by this enzyme
- The profiling can be used to predict drug-drug interactions
- The CYP450 variants have no influence on drug metabolism

Answer :

Other Questions

You have a friend that is a marathoner and an entrepreneur. He doesn't like lactic acid buildup in his muscles and is tired of them getting so hot when he exerc

if a mutation is made within the active site of an enzyme resulting in a decrease in km, which of the following will be true with respect to the enzyme kinetics

A scientist determined the rate of an enzyme-catalyzed reaction by measuring the amount of product formed over time. The following curve was generated from the

You continue your analysis by crossing the forked and twist lines. Your results are as follows: Which of the following statements best explains the outcome of t

Read each question carefully. Write your response in the space provided for each part of each question Answers must be written out in paragraph form. Outlines,

When an enzyme is present in the R-conformation it usually binds which of the following with the greatest affinity? An allosteric activator O A competitive inhi

A variety of factors influence enzyme activity. Substances that bind to the enzyme and interfere with substrate binding or catalysis are inhibitors. Identify th

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

Question 3 A Amylase is a protein that catalyzes the conversion of starch to simple sugars. Amylase activity in an aqueous solution can be measured by using iod

The letters in the diagram below represent genes on a particular chromosome. Gene B contains the code for an enzyme that cannot be synthesized unless gene A is