gabe4384 gabe4384

27-12-2022
Biology

Answered

The processes illustrated in the models depicted above all result in which of the following?
A) Transcription
B) An increase in genetic variation
C) horizontal gene transfer
D) an increase in the chromosome number

Answer :

Other Questions

The letters in the diagram below represent genes on a particular chromosome. Gene B contains the code for an enzyme that cannot be synthesized unless gene A is

gene encodes a protein with the following amino acid sequence: a nonsense mutation caused by a single-base-pair substitution occurs in this gene, resulting in a

Te enzyme trypsin aids in protein digestion in the small intestine. Te relative activity of trypsin at diferent pH values is shown in Figure 1. Which of the fol

If an individual had an excess of ADH in their bloodstream, they retain more water. What do you think would happen to the urine because of it? Would it have mor

You have a friend that is a marathoner and an entrepreneur. He doesn't like lactic acid buildup in his muscles and is tired of them getting so hot when he exerc

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

A researcher designs an experiment to investigate whether soil bacteria trigger the synthesis of defense enzymes in plant roots. The design of the experiment is

Many biological structures are composed of smaller units assembled into more complex structures having functions based on their structural organization. For THR

In a large, randomly mating, population, the frequency of the allele for sickle-cell hemoglobin (s) is 0.028. The results of studies have shown that people with

A scientist determined the rate of an enzyme-catalyzed reaction by measuring the amount of product formed over time. The following curve was generated from the