dominatord7021 dominatord7021

27-12-2022
Biology

Answered

The sensory portion of the PNS carries electrical signals the CNS; the motor portion carries electrical signals the CNS.
toward, also toward away from, also away from
away from, toward toward, away from

Answer :

Other Questions

in the cochlea, specialized cells called hair cells convert the vibrations into electrical signals. these signals are then sent through the auditory nerve to th

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

This data table shows how quickly rope will rot away in freshwater and saltwater. what can you conclude about the rates of the rotting reaction? A. The reaction

An S wave is a type of seismic wave called a transverse wave . Transverse waves occur when the material that carries the waves moves up and down or side to sid

Name two organelles from the cell body (the main part of the cell) that are involved in preparing for the release of neurotransmitters.

A scientist determined the rate of an enzyme-catalyzed reaction by measuring the amount of product formed over time. The following curve was generated from the

A break in a blood vessel occurs and damaged cells release chemicals to begin the process of blood clotting. As clotting gets under way, signals are sent by cel

Switching from low power to high power the field of view appears dark: to adjust use the

All the following characterize neurosecretory cells except that they group of answer choices O release hormones into the blood. O affect specific target cells o

Alligators are predators that live in the Florida Everglades. A scientist is using a computer model to determine whether the alligator is a keystone species in