litttyyyu2522 litttyyyu2522

27-12-2022
Biology

Answered

The letters in the diagram below represent genes on a particular chromosome.
Gene B contains the code for an enzyme that cannot be synthesized unless gene A is also active. Which statement best explains why this can occur?
(1) A hereditary trait can be determined by more than one gene.
(2) Genes are made up of double-stranded segments of DNA.
(3) All the genes on a chromosome act to produce a single trait.
(4) The first gene on each chromosome controls all the other genes on the chromosome.

Answer :

Other Questions

The processes illustrated in the models depicted above all result in which of the following? A) Transcription B) An increase in genetic variation C) horizontal

gene encodes a protein with the following amino acid sequence: a nonsense mutation caused by a single-base-pair substitution occurs in this gene, resulting in a

E. coli bacteria are placed into a medium containing glucose and lactose. Which of the genes below do you expect to be turned on? f-galactosidase Lac I Lac P Pe

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

the trait represented by the colored circles and squares below is inherited as a dominant allele. this is not a sex-linked trait. shaded individual show the dom

A scientist determined the rate of an enzyme-catalyzed reaction by measuring the amount of product formed over time. The following curve was generated from the

Many biological structures are composed of smaller units assembled into more complex structures having functions based on their structural organization. For THR

If the normal spermatogenesis is disrupted, the gametes can have different chromosomes than expected. Which of the following is the most likely cause of one of

(b) based on the diagram, describe how the structure of these organelles controls movement across the membranes.

e. coli bacteria are placed into a medium containing both glucose and lactose. which of the gene products (i.e., enzymes) listed below do you predict will be fu