NataliaD2871 NataliaD2871

27-12-2022
Biology

Answered

choose any two commercial fishing practices from the list below. for each of your choices, describe the practice and explain the role it plays in the depletion of marine organisms. Bottom trawling
Long line fishing
Using drift nets/gill nets/purse seines
Using sona

Answer :

Other Questions

. using the pictures below, identify the phases of the cell cycle using the words: interphase, prophase, metaphase, anaphase, telophase and cytokinesis

6. A high school student conducted an experiment. The student grew two organisms alone in a petri dish. In graph "a" species 1 is shown growing alone, and in gr

Mark all examples of evolutionary adaptation: Group of answer choices O the cryptic appearance of the moth Abrostola trigemina, which looks like a broken twig.

If an individual had an excess of ADH in their bloodstream, they retain more water. What do you think would happen to the urine because of it? Would it have mor

2. What is happening on section A of the graph? Justify your reasoning. Include a term to describe this part of the graph.

Use the following graph to answer questions 1-5 Harbor seals have a tendency to populate harbors. The following is data that a biologist has kept on the number

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

Read each question carefully. Write your response in the space provided for each part of each question Answers must be written out in paragraph form. Outlines,

A portion of a molecule is shown in the diagram below. Which statement best describes the main function of this type of molecule? Select one: a. it determines w

The streamlined shape of the dolphin, seal and other swimming animals is most important for A) overcoming the forces of gravity acting on the animal B) reducing