jasenny77 jasenny77

26-12-2022
Biology

Answered

11. In 1996 the moose population dropped, what then happened to the wolf population in the following
year? Explain why.

11 In 1996 the moose population dropped what then happened to the wolf population in the following year Explain why class=

Answer :

Other Questions

The National Park Service (NPS) has been monitoring the continued decline of the wolf population on Isle Royale. Scientists have found that many of the wolves i

Use the following graph to answer questions 1-5 Harbor seals have a tendency to populate harbors. The following is data that a biologist has kept on the number

Which of the following reactions is unlikely to occur in the ocean as atmospheric CO2 continues to rise? a decrease in the population of calcifying organisms an

Which of the following MUSt exist in population before natural selection can act upon that population? genetic variation among individuals B) variation among in

In a large, randomly mating, population, the frequency of the allele for sickle-cell hemoglobin (s) is 0.028. The results of studies have shown that people with

Alligators are predators that live in the Florida Everglades. A scientist is using a computer model to determine whether the alligator is a keystone species in

6. A high school student conducted an experiment. The student grew two organisms alone in a petri dish. In graph "a" species 1 is shown growing alone, and in gr

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

Explain how growers might intervene in the plant's life cycle to solve these problems??

to undergo meiosis. which of the following best describes the steps these cells will follow to form gametes?