gultafotie gultafotie

26-12-2022
Biology

Answered

The poly A tail is NOT added to an mRNA during RNA processing . How would this affect the mRNA's journey to the ribosome?

Answer :

Other Questions

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

Refer to the equation below to answer this question. What are the REACTANTS of this chemical reaction??

You have a friend that is a marathoner and an entrepreneur. He doesn't like lactic acid buildup in his muscles and is tired of them getting so hot when he exerc

I don't know how to answer this questions help me

Help me to answer this questions

Of the following events that occur during meiosis, which contributes most to genetic diversity in the human population? Select one: a. Alignment of sister chrom

The graph below shows what happens during both chemical reactions A and B. Which of the following BEST describes this graph

You have been asked to review a medical device that will be used to monitor the breathing pattern of premature infants in a Neonatal Intensive Care Unit (NICU).

Please help me to answer this questions

___ Codes for proteins that determine the phenotype of an organism. not all proteins are transcribed in a single cell some ___ are turned off so that the ___ is