dilp30383 dilp30383

25-12-2022
Biology

Answered

Mutational signatures of p53 are shown in the figure (G.P. Pfeifer et al., Nature, 21(48), 2002) for the three types of cancer with the highest death rates in the United States: lung (~225,000 deaths in 2016), breast (246,000), and colorectal (381,000).

As shown under each graph in the figure, particular transversions (replacement of a pyrimidine by a purine of vice versa) or transitions (replacement of a purine or pyrimidine by the alternative purine or pyrimidine) are features of specific mutational signatures.

Based on these data, identify the transversion or transition that seems to be induced by cigarette smoke.

Answer :

Other Questions

what is the skeletopy, synotopy and holotopy of the lung?

In a large, randomly mating, population, the frequency of the allele for sickle-cell hemoglobin (s) is 0.028. The results of studies have shown that people with

29. In a genetic engineering experiment a piece of double-stranded DNA containing 18000 nucleotides coding for a specific polypeptide is transcribed and transl

old-growth forests can be described by which of the following group of answer choices a clear forest floor free of dead wood or debris are considered good choic

You have been asked to review a medical device that will be used to monitor the breathing pattern of premature infants in a Neonatal Intensive Care Unit (NICU).

Which of the following could be elements of cytoarchitecture, as related to Brodmann’s microscopic studies of the cerebral cortex? a. connections to the cerebel

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

which of the following foods are good sources of preformed or active vitamin a? (select all that apply.) a. carrots b. sweet potatoes c. leafy greens d. milk e.

-------- alveolar cells provide the primary diffusional area for gas exchange with the blood in the lung

all organisms face trade-offs that arise from the constraints that they face. one example of a constraint: energy spent on one task cannot be spent on another.