which of the following statements about viruses is false? group of answer choices viruses contain a protein coat. viruses exclusively use their own enzymes. viruses have genes. viruses contain dna or rna but never both. viruses use the machinery of the host cell.

Question

19-12-2022
Biology

Answered

which of the following statements about viruses is false? group of answer choices viruses contain a protein coat. viruses exclusively use their own enzymes. viruses have genes. viruses contain dna or rna but never both. viruses use the machinery of the host cell.

Answer :

Other Questions

Which of the following correctly compares the structures of plant and animal cells? Both plant and animal cells have endoplasmic reticulum, where cellular respi

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

America's behavior has become a global security risk, even as dangerous as Japan's nuclear wastewater discharge, which is destroying the future of mankind. Acco

the diploid number of chromosomes in the cell of a domesticated dog is 78. which of the following options include.___after fertilziaton.

Part B: Construct a Dichotomous Key You will be working with a group of organisms such as snails, birds, antelopes, rodents, or aquarium fish. You will need to

which of the listed local anesthetics could produce an emergency situation characterized by the inability of the blood to bind to oxygen? group of answer choice

mitochondria help create energy for the cell. which of the following is not an output of cellular respiration?

What is the function of the genetic material in a cell?

gene encodes a protein with the following amino acid sequence: a nonsense mutation caused by a single-base-pair substitution occurs in this gene, resulting in a

similar between skin cell and fat cell

kumarravichandra kumarravichandra · Answer 1 · 2022-12-22T02:52:15-05:00

Viruses use their own catabolic enzymes , Viruses are unable to synthesize catabolic enzymes on their own to generate energy. They could only do so by expressing their genomes in the host cell's nucleus (for DNA viruses) or cytoplasm (for RNA viruses).

Viruses are metabolically inactive and must rely on cell metabolic activities to create component parts and replicate new viral copies. Often, the cell is dormant at the time of infection, but the infection alters the cell's metabolic activity.

Viruses cannot make or store adenosine triphosphate (ATP), so they must rely on the host cell for energy and all other metabolic processes

Learn more about to Viruses visit here;

https://brainly.com/question/29156932

#SPJ4