there are two distinct ways in which the basic body tissues become arranged during the development of a fertilized egg. in , such as insects and earthworms, the first opening to form in the embryo becomes the mouth, whereas in , such as humans and sea stars, the mouth forms from the second embryonic opening.

Question

19-12-2022
Biology

Answered

there are two distinct ways in which the basic body tissues become arranged during the development of a fertilized egg. in , such as insects and earthworms, the first opening to form in the embryo becomes the mouth, whereas in , such as humans and sea stars, the mouth forms from the second embryonic opening.

Answer :

Other Questions

America's behavior has become a global security risk, even as dangerous as Japan's nuclear wastewater discharge, which is destroying the future of mankind. Acco

A scientist determined the rate of an enzyme-catalyzed reaction by measuring the amount of product formed over time. The following curve was generated from the

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

Do the tissues lining the gastrovascular cavity in Cnidarians differ at any point in the cavity?

You have been asked to review a medical device that will be used to monitor the breathing pattern of premature infants in a Neonatal Intensive Care Unit (NICU).

one female contraceptive vaccine that is currently being researched is intended to immunize women against the hcg, which is necessary to maintain the implantati

The rule for a number pattern is to multiply each number by 3. The first number is shown. Enter a number in each box to show the next three numbers in the patte

The rule for the number pattern is to multiply each number by 3 and then subtract 2. Enter a number in each box to show the next three numbers in the pattern. 4

. Look up current ocean pH values. How do the current values compare to those from previous years? ((my answer: 8.1 pH today and 8.2 pH previously (slightly bas

What is the function of the genetic material in a cell?

kumarravichandra kumarravichandra · Answer 1 · 2022-12-22T02:54:52-05:00

An organ is a structure made up of two or more tissue types that work together to perform a specific function.

A blastocyst is a ball of cells that develops early in a pregnancy, around five to six days after a sperm fertilizes an egg. It implants in your uterine wall and develops into an embryo, then a fetus.

Fertilization initiates the early phases of embryonic development. Fertilization is closely monitored to ensure that just one sperm unites with one egg. The zygote undergoes cleavage after fertilization to generate the blastula.

Members of major taxonomic groups of animals are classified as protostome or deuterostome based on how they grow as embryos.

Learn more about to tissue visit here;

https://brainly.com/question/17664886

#SPJ4