Which statement best describes the relationship between the hypothalamus and the pituitary gland?The hypothalamus produces releasing hormones that promote the release of particular hormones from the anterior pituitary

Question

16-12-2022
Biology

Answered

Which statement best describes the relationship between the hypothalamus and the pituitary gland?The hypothalamus produces releasing hormones that promote the release of particular hormones from the anterior pituitary

Answer :

Other Questions

g you have a different mutant mouse who has low blood glucose in response to stress and you do not know where the mutation is. to help find out, you remove thei

to undergo meiosis. which of the following best describes the steps these cells will follow to form gametes?

in biology, the relationship between form and function is critical. briefly explain how this is apparent at the level of the cell. your answer should include a

what is the skeletopy, synotopy and holotopy of the lung?

a student studying bird development recorded the mass of eggs from the time they were laid until the time they hatched in order to relate the mass of the egg to

You have been asked to review a medical device that will be used to monitor the breathing pattern of premature infants in a Neonatal Intensive Care Unit (NICU).

choose the term that describes a bacteriophage infection in which the host bacteria are lysed and killed by the infection

alex listed the typical steps of fossil formation.1) an organism dies.2) the remains fall to the bottom of the ocean.3) the soft portions decay, and the hard po

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

in fruit flies red eye color (R) is dominant to white eyes (r) in a cross between two flies, 50% of the male and 50% of the female offspring had red eyes. The o

syadzayasmine syadzayasmine · Answer 1 · 2022-12-19T21:45:46-05:00

The statement best describes the relationship between the hypothalamus and the pituitary gland is the hypothalamus produces releasing hormones that promote the release of particular hormones from the anterior pituitary. The correct answer is B

Since your hypothalamus controls it by secreting the "releasing hormones" somatostatin and dopamine through blood vessels in the pituitary stalk, your anterior pituitary interacts with it directly. The production and release of anterior pituitary hormones is either stimulated or inhibited (prevented) by these releasing hormones. Your anterior pituitary and hypothalamus are constantly communicating with one another.

The pituitary gland is referred to as the body's main gland. The anterior pituitary and posterior pituitary are the two primary sections of the pituitary. The pituitary gland releases a number of hormones.

The pituitary gland's operation is controlled by the hypothalamus. Different hormones that release and inhibit are released by the hypothalamus. These hormones function and promote pituitary gland activity. The hypothalamus affects the pituitary gland's secretion of several hormones.

Your question is incomplete but most probably your full question was

which statement best describes the relationship between the hypothalamus and the pituitary gland?

a. the anterior pituitary gland makes hormones that are released by the hypothalamus

b. the hypothalamus produces releasing hormones that promote the release of particular hormones from the anterior pituitary

c. the hypothalamus produces releasing hormones that promote the release of particular hormones from the posterior pituitary

d. the posterior pituitary sends nervous signals to the hypothalamus to prompt the release of hormones

Learn more about pituitary gland at https://brainly.com/question/4599004

#SPJ4