sharidler sharidler

15-12-2022
Biology

Answered

original DNA: TACTTTAATCCCAAATTTACT

DNA: TACTTTAATCCCAAGTTTACT
mRNA: ?
amino acid: ?
what type of mutation is this: ?

Answer :

Other Questions

here is a hypothetical mrna sequence: 5' c g g a u g c g u a a a u a g 3' what is the amino acid sequence encoded by this mrna?

Which of the following are true about eukaryotic cells? There are 5 correct answers. Question 16 options: first cells, prefix meaning "before," thought to be ea

ere is a hypothetical mrna sequence: 5' g a u g c g u a a a u a g 3' what is the amino acid sequence encoded by this mrna?

When chromosomes fail to separate correctly in meiosis, what can occur? Question 24 options: extra chromosomes are found in the sex cell chromosomes of the sex

Why is genetic variation for necessary for evolution by natural selection? Group of answer choices Genetic variation results in different traits which can be se

Suppose that there was an enzyme that cuts bonds between deoxyribose and phosphate groups. what would this enzyme do to a dna molecule?

here is a portion of a hypothetical dna sequence: 3' t t c g a a c c g a g 5' suppose this sequence is part of the template strand of a gene. the sequence of th

The fourth and final phase of mitosis or meiosis during which a nuclear membrane forms around chromosomes on opposite sides of the cell and the chromosomes beco

PLS HELP Answer the following questions. The skin of a dog has 74 chromosomes. a. how many chromosomes are in each sperm cell? b. how many chromosomes are in ea