KCase6445 KCase6445

13-12-2022
Biology

Answered

asher suffers from claustrophobia, a fear of closed spaces. his therapist suggests that his reaction to closed spaces is a generalization of the fear triggered by his childhood experience of being accidentally locked in his closet. the therapist's suggestion indicates that he believes asher's fear results from : A. Conditioning B. Repression C. Epigenetic marks D.A biological predisposition

Answer :

Other Questions

In the readings, a claim is made that ice cooling is a good way to cool large buildings. Create an argument to support this claim. Give reasons and evidence fro

which of the following is the best example of gene flow? group of answer choices genes are shuffled by chromosomal crossing over during meiosis. wind blows poll

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

from the following choices, choose all of the answers that increase the genetic variation among individuals in a sexually reproducing population of a plant that

Vygotsky theory emphasizes which of the following factors in a child's development? - social interactions in cultural contexts - individual differences in traje

You have a friend that is a marathoner and an entrepreneur. He doesn't like lactic acid buildup in his muscles and is tired of them getting so hot when he exerc

a student studying bird development recorded the mass of eggs from the time they were laid until the time they hatched in order to relate the mass of the egg to

a compound that preents teh seperation of the homogous chromsoems in anaphase 1 is being studid. which fo the followign questions can be best answered during th

You have been asked to review a medical device that will be used to monitor the breathing pattern of premature infants in a Neonatal Intensive Care Unit (NICU).

one female contraceptive vaccine that is currently being researched is intended to immunize women against the hcg, which is necessary to maintain the implantati