yaneiryx5766 yaneiryx5766

12-12-2022
Biology

Answered

Lions and tigers sometimes breed in zoos, but hybrids have not been seen in nature and even in zoos they do not reproduce well. Which of the following statements is the best conclusion that can be derived from this information?

Answer :

gouthami123 gouthami123

17-12-2022

The hybridization of lions and tigers is not a sustainable practice in zoos.

Give some facts of tiger and lion?

Tiger

• The scientific name for the tiger is Panthera tigris.

• Tigers are the largest of all wild cats, with some males reaching up to 11 feet in length and weighing up to 660 pounds.

• Tigers have a lifespan of 10 to 15 years in the wild, but can live up to 25 years in captivity.

• Tigers are solitary creatures, spending most of their time alone.

• Tigers are carnivorous, and their diet includes large mammals such as deer, wild boar, and buffalo.

Lion

• The scientific name for the lion is Panthera leo.

• Lions are the second-largest living cats, after tigers.

• Male lions can weigh up to 550 pounds and can be up to 9 feet long.

• Lions live in large groups called prides, which can include up to 30 individuals.

• Lions are carnivores, and their diet consists of large mammals such as antelope, zebra, and wildebeest.

To learn more about breeds refer to:

https://brainly.com/question/1042666

#SPJ1

Answer Link

Other Questions

which of the following is not true of stem cells ?they can be used to synthesize proteins important in medicine they can divide indefinitely they are capable of

what is a pluripotent stem cell? cells found in the inner cell mass that of the blastocyst that can differentiate into any of the cell types except placental ce

a compound that preents teh seperation of the homogous chromsoems in anaphase 1 is being studid. which fo the followign questions can be best answered during th

from the following choices, choose all of the answers that increase the genetic variation among individuals in a sexually reproducing population of a plant that

You have been asked to review a medical device that will be used to monitor the breathing pattern of premature infants in a Neonatal Intensive Care Unit (NICU).

old-growth forests can be described by which of the following group of answer choices a clear forest floor free of dead wood or debris are considered good choic

Eukaryotic messenger RNA can undergo post synthetic processing after transcription and before translation: One of the processing steps is splicing, where portio

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

Which of the following should be labeled with the patient's name, the date and time of collection, and the initials of the person collecting the specimen?

a student studying bird development recorded the mass of eggs from the time they were laid until the time they hatched in order to relate the mass of the egg to