(True or False) the body's adipostat utilizes a negative feedback mechanism that maintains a certain amount of adipose tissue.

Question

05-12-2022
Biology

Answered

(True or False) the body's adipostat utilizes a negative feedback mechanism that maintains a certain amount of adipose tissue.

Answer :

Other Questions

Compare skeletal, smooth, and cardiac muscles as to their microscopic anatomy, location and arrangement in body organs, and function in the body.

Cold sores on the skin of the mouth occur when herpes simplex viruses that are dormant in neural ganglia become active and travel to the skin of the mouth. Whic

these images illustrate a(n) a. monohybrid cross. b. complete dominance of body size alleles. c. incomplete dominance of body size alleles. d. dihybrid cross.

what is a pluripotent stem cell? cells found in the inner cell mass that of the blastocyst that can differentiate into any of the cell types except placental ce

ATP is required for RNA-Pol to move down dsDNA, hydrolysis of ATP provides the energy to unwind the strands in front of RNAP while rewinding them behind. O True

Eukaryotic messenger RNA can undergo post synthetic processing after transcription and before translation: One of the processing steps is splicing, where portio

True/False mineral nutrients are cycled through ecosystems and their environment. water, carbon, nitrogen, phosphorus and sulfur are of particular importance. h

from the following choices, choose all of the answers that increase the genetic variation among individuals in a sexually reproducing population of a plant that

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

old-growth forests can be described by which of the following group of answer choices a clear forest floor free of dead wood or debris are considered good choic

kumarravichandra kumarravichandra · Answer 1 · 2022-12-08T02:42:04-05:00

The body's adipostat utilizes a negative feedback mechanism that maintains a certain amount of adipose tissue is true.

The stored form of fatty acids, triacylglycerol, is hydrolyzed to release them from adipose tissue. Hormone-sensitive lipase, a hydrolytic enzyme, is activated to begin hydrolysis (HSL). Activated in the phospho-form, HSL is a phospho-dephospho enzyme.

Because it serves as a caloric reserve, adipose tissue is an important regulator of systemic energy balance. When there is an abundance of nutrients, the adipose tissue stores the extra nutrients as neutral lipids, but when there is a shortage of nutrients, it uses lipolysis to provide nutrients to other tissues.

Learn more about to adipose tissue visit here;

https://brainly.com/question/10997272

#SPJ4