kennettzone5907 kennettzone5907
  • 10-11-2022
  • Biology
Answered

elow is the coding strand of a small gene that codes for a peptide. assume the gene has a traditional start codon. how many amino acids long is the peptide if we assume traditional start and traditional stop codon? 5' aatccgtatctatgaccgtttggaaacactaagcggtactc 3'



Answer :

Other Questions

how is translation initiated? view available hint(s)for part a hint 1for part a. how is translation initiated? the start codon signals the start of translation
item 7 although 61 different codons code for amino acids, cells contain fewer than 61 different trnas. why?
assume an individual has only 1 chromosome. they are diploid, which means they have two copies of this chromosome. what process helps explain why 50% of the gam
a spontaneous point mutation may be caused during dna replication when the enzyme puts the wrong base in a newly-synthesized strand.
which of the following is not one of the functions of the lymphatic system? group of answer choices help the body defend against disease calcium homeostasis abs