tiara08 tiara08

03-11-2022
Biology

Answered

Question 4
Below is the CODING STRAND of a small gene that codes for a peptide. Assume the gene has a
traditional start codon.
How many amino acids long is the peptide if we assume traditional start and traditional stop
codon?
5' AATCCGTATCTATGACCGTTTGGAAACACTAAGCGGTACTC 3'
3
5
6
9

Answer :

Other Questions

250 500 2500 A (D) 1000 1000 500' C 3500 B 2500 What is the contour interval for this map in feet? A100 2000 1500

2) The universal genetic code is comprised of 64 codons that encode the 20 possible amino acids that are joined together to produce proteins. What comprises a c

Question 1Explain ehy the earth orbits the sunQuestion 2Explain the law of Universal Gravitation IN YOUR OWN WORDS!(PLEASE HURRY, I NEED THIS DONE BY TODAY TYSM

Question 1Explain ehy the earth orbits the sunQuestion 2Explain the law of Universal Gravitation IN YOUR OWN WORDS!(PLEASE HURRY, I NEED THIS DONE BY TODAY TYSM

Question 9 of 10 What happens when an atom loses an electron? A. It has an increase in the number of protons. B. It has a decrease in the number of neutrons. C.

Wind has no effect on a plants respiration rate O True False Question 2 (2 points) Where sugars are formed are refered to as the sink True O False Question 3 (

Inquiry Chart How does solar radiation affect climate? How do the ocean currents affect the climate? How does climate change affect the ocean? How does climate

PLEASE HELP Which activity is anaerobic? A. mile-run B. weight training C. stretching D. jogging

Write a 250 word response on the below. • Science has had a negative impact on society and will ultimately lead to the destruction of the human race. (Your re

Submit your project researching some environmental problems caused by the agriculture and natural resource industry. Be sure your essay Includes the following: