KalinR431209 KalinR431209

29-10-2022
Biology

Answered

2. You step outside on a 90 degree summer day. After 1 minute. your body beginsto sweat. As the sweat evaporates off your skin, heat is lost from the body andyour internal temperature begins to decrease.ChoosePositive feedbackNegative feedback

Answer :

Other Questions

The map below shows two cities in Michigan. Petoskey Reset Ann Arbor The average temperature in July for Ann Arbor is 83°F and the average temperature for July

Which of the following is evidence that matter is too small to be seen without magnification?O Feeling the heat come off the flames of a fireFeeling the grains

You pick 3 digits (0-9) at random without replacement and write them in the order picked. What is the probability that you have written the first 3 digits of yo

6. Below is a graph that shows enzyme activity and temperature.Why does the graph slope down sharply once the temperature increases to over 40 degrees?The struc

According to the cladogram below, which of the following organisms had asegmented body and jaws but no limbs?OA. DOB. EOC. COD. F

How do you know that your design team has considered enough ideas to ensure that they develop a good design?Its rom my science book on chapter 1.Is it alright i

Question 5 Insert any nucleotide in the Reading Frame and show the new amino acid sequence after Transcribing. 5' acgatgcattgtccagcactgacgtaatata' 3' gatacgtaa

I need help with this practice Answer this in 3 sentences in your own words

I need help with this practice problem solving In your words answer pic

A person is homozygous recessive for the recessively inherited disease cystic fibrosis. Their partner is normal. What genotype could the partner be in order to