Paul is a first-year graduate student working in a bacterial pathogenesis lab focused on finding therapeutic drugs to target a specific bacterial organism. Since Paul was new to research he did not fully understand why it was important to use a newly grown bacterial culture for each experiment and thus decided to use a 5-day old bacterial culture to repeat his experiments. When his experimental results were drastically different he decided to sequence the DNA of the 5-day old bacteria and compare it to his original culture. His results showed that a metabolic gene with the following RNA sequence AUGUCUGGUGGUGAACGCGUG underwent a spontaneous mutation and the underlined ‘C’ was changed to an ‘A’.

Answer the following questions:

1. What is the amino acid sequence before the mutation?
2. What is the amino acid sequence after the mutation?
3. What specific type of mutation occurred?
4. What enzyme was responsible for this mutation? Explain why you chose that enzyme.